Transcription (chapter 10)
Lecture Topics/Genetics Home Page
Assignment #2. This assignment is due on January 28, 2000.
- The following is a single strand of DNA. Supply a strand, by the rules of complementarity, that would turn this strand into a double helix.
5 ATTCGGCATATTG 3
- During DNA replication, one strand of DNA is replicated in a discontinuous fashion. Why is this necessary?
- If the enzyme ligase doesnt function properly in a bacterial cell, what may happen during DNA replication? (What may be the result of attempted DNA replication?)
- In the Science article, "Bringing the Mountain to Mohammed" by R. Losick and L. Shapiro (handout on January 14), the authors discuss evidence of DNA "replication factories" in a bacterium (Bacillus subtilis). IN YOUR OWN WORDS, describe this evidence. That is, describe Lemon and Grossman's study and the results of it.
- In the following RNA sequence, determine the sequence of both strands of the DNA from which it was transcribed. Indicate the 5 and 3 ends of the DNA and circle the strand that was transcribed (was the template in transcription).
5 CUGAACCAUGGCCAAUUCCGCGAAUC 3
- The following DNA fragment represents the beginning of a gene. Determine which strand is transcribed (is the template) and indicate the polarity of both strands in the DNA. Also, indicate the sequence of the transcribed RNA and its polarity.
ATGAGGGTACAAGCTACAACTATT
TACTCCCATGTTCGATGTTGATAA
- What are the functions of the consensus sequences TATAAT and TTGACA located on the coding strand of DNA at about 10 and 35 bases (respectively) upstream from the first base transcribed in prokaryotic transcription?
- Describe (in some detail) one way in which pre-messenger RNA is modified before it leaves the nucleus as mRNA (in eukaryotic cells).
9. Tamarin, Chapter 10, question 22. Would introns be more or less likely than exons to accumulate mutations through evolutionary time? Why?
10. A given part of an RNA strand is shown below. What is the sequence of amino acids made by translation of this RNA strand?
5" ....AUGATACCGGAAACGAUAGAACAU....3'
11. Chapter 11: Question #31 (Tamarin). A normal protein has histidine in a given position. Four mutants are isolated and determined to have the following amino acids instead of histidine: tyrosine, glutamine, proline, or leucine. What are the possible codon assignments and what codon is probably used for histidine?
12. A segment of a normal protein and three different mutants appear below. Explain what kind of mutation occurred in each of the mutant proteins.
normal protein segment: leu-pro-ser-gln-arg
mutant #1: leu-pro-ser
mutant #2: leu-thr-gln-arg-glu
mutant #3 phe-pro-ser-gln-arg
Questions that are great for reviewing DNA replication, transcription, and translation include the following questions from Tamarin (NOT part of the assignment!).
Chapter 9: 14, 16, 17, 18, 23
Chapter 10: 1, 3, 5, 6, 11, 12, 16, 17, 22, 30
Chapter 11: 1, 3, 4, 10, 11, 13, 14, 19, 28, 29, 31